crispr guide constructs targeting tet1 (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
crispr guide constructs targeting tet1
Crispr Guide Constructs Targeting Tet1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 235 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+constructs/lentiCRISPR+v2-Blast+(Plasmid+%2383480)/pm42869907-371-0-18
Average 96 stars, based on 235 article reviews
Crispr Guide Constructs Targeting Tet1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 235 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/lenticrispr+constructs/lentiCRISPR+v2-Blast+(Plasmid+%2383480)/pm42869907-371-0-18
Average 96 stars, based on 235 article reviews
crispr guide constructs targeting tet1 - by Bioz Stars,
2026-10
96/100 stars
Images
Related Articles
Construct:Article Title: A NPAS4–NuA4 complex couples synaptic activity to DNA repair Article Snippet: .. To generate Article Title: Acid-adapted cancer cells alkalinize their cytoplasm by degrading the acid-loading membrane transporter anion exchanger 2, SLC4A2. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: VACO10MS Human: VACO4A Human: VACO4S Human: VACO5 WBL WBL WBL WBL N/A N/A N/A N/A Human: MIA Pa-Ca-2 Prof. Alessandra Fiorio, University of Lille, France N/A Human PANC-1 Prof. Anna Trauzold, University of Kiel, Germany N/A Experimental models: Organisms/strains Female athymic Nude Crl:NU(NCr)-Foxn1nu mice Charles River N/A Biological samples Matched Pair – Paraffin Tissue Section BioChain T8235090 Oligonucleotides LentiCRISPR sgSLC4A2 AAGAATCTGCGCCCTTGGCG Invitrogen N/A LentiCRISPR sgNDUFS1 TAGAATGTATGCCTACTTGG Invitrogen N/A siGENOME siControl Dharmacon D-001210-01-05 siGENOME siBNIP3 Dharmacon M-004636-01-0005 siGENOME siPEG10 Dharmacon M-032579-01-0005 siGENOME siSLC16A7 Dharmacon M-007409-01-0005 siGENOME siATP6V0A2 Dharmacon M-019950-00-0005 siGENOME siCEACAM6 Dharmacon M-015306-01-0005 siGENOME siPMP22 Dharmacon M-010616-02-0005 siGENOME siCA9 Dharmacon M-005244-02-0005 siGENOME siSLC4A2 Dharmacon M-007582-01-0005 siGENOME siSLC4A3 Dharmacon M-007583-02-0005 siGENOME siSLC26A3 Dharmacon M-007492-00-0005 siGENOME siSLC26A6 Dharmacon M-007494-01-0005 siGENOME siTFEB Dharmacon M-009798-02-0005 siGENOME ATG5 Dharmacon M-004374-04-0005 Recombinant DNA lentiCRISPR v2 Sanjana et al., 201459 Addgene: 52961 Article Title: Relative expression of KLK5 to LEKTI is associated with aggressiveness of oral squamous cell carcinoma Article Snippet: Both synthesis of primers and oligos and sequencing of PCR products and clones were performed at the Food and Drug Administration - Center for Biologics Evaluation and Research (CBER) Facility for Biotechnology Resources at National Institutes of Health (Bethesda, MD, USA). .. The generated Article Title: Dynamic IL-6R/STAT3 signaling leads to heterogeneity of metabolic phenotype in pancreatic ductal adenocarcinoma cells. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains 5-alpha Competent E. coli (High Efficiency) New England Biolabs C2987H Premo FUCCI Cell Cycle Sensor (BacMam 2.0) Life Technologies P36238 Recombinant DNA Laconic/pcDNA3.1( ) San Martin et al., 201325 Addgene: 44238 lentiCRISPR v2 Sanjana et al., 201449 Addgene: 52961 Cell Culture:Article Title: A NPAS4–NuA4 complex couples synaptic activity to DNA repair Article Snippet: .. To generate Clone Assay:Article Title: A NPAS4–NuA4 complex couples synaptic activity to DNA repair Article Snippet: .. To generate Recombinant:Article Title: Acid-adapted cancer cells alkalinize their cytoplasm by degrading the acid-loading membrane transporter anion exchanger 2, SLC4A2. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: VACO10MS Human: VACO4A Human: VACO4S Human: VACO5 WBL WBL WBL WBL N/A N/A N/A N/A Human: MIA Pa-Ca-2 Prof. Alessandra Fiorio, University of Lille, France N/A Human PANC-1 Prof. Anna Trauzold, University of Kiel, Germany N/A Experimental models: Organisms/strains Female athymic Nude Crl:NU(NCr)-Foxn1nu mice Charles River N/A Biological samples Matched Pair – Paraffin Tissue Section BioChain T8235090 Oligonucleotides LentiCRISPR sgSLC4A2 AAGAATCTGCGCCCTTGGCG Invitrogen N/A LentiCRISPR sgNDUFS1 TAGAATGTATGCCTACTTGG Invitrogen N/A siGENOME siControl Dharmacon D-001210-01-05 siGENOME siBNIP3 Dharmacon M-004636-01-0005 siGENOME siPEG10 Dharmacon M-032579-01-0005 siGENOME siSLC16A7 Dharmacon M-007409-01-0005 siGENOME siATP6V0A2 Dharmacon M-019950-00-0005 siGENOME siCEACAM6 Dharmacon M-015306-01-0005 siGENOME siPMP22 Dharmacon M-010616-02-0005 siGENOME siCA9 Dharmacon M-005244-02-0005 siGENOME siSLC4A2 Dharmacon M-007582-01-0005 siGENOME siSLC4A3 Dharmacon M-007583-02-0005 siGENOME siSLC26A3 Dharmacon M-007492-00-0005 siGENOME siSLC26A6 Dharmacon M-007494-01-0005 siGENOME siTFEB Dharmacon M-009798-02-0005 siGENOME ATG5 Dharmacon M-004374-04-0005 Recombinant DNA lentiCRISPR v2 Sanjana et al., 201459 Addgene: 52961 Article Title: Dynamic IL-6R/STAT3 signaling leads to heterogeneity of metabolic phenotype in pancreatic ductal adenocarcinoma cells. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains 5-alpha Competent E. coli (High Efficiency) New England Biolabs C2987H Premo FUCCI Cell Cycle Sensor (BacMam 2.0) Life Technologies P36238 Recombinant DNA Laconic/pcDNA3.1( ) San Martin et al., 201325 Addgene: 44238 lentiCRISPR v2 Sanjana et al., 201449 Addgene: 52961 Software:Article Title: Acid-adapted cancer cells alkalinize their cytoplasm by degrading the acid-loading membrane transporter anion exchanger 2, SLC4A2. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Human: VACO10MS Human: VACO4A Human: VACO4S Human: VACO5 WBL WBL WBL WBL N/A N/A N/A N/A Human: MIA Pa-Ca-2 Prof. Alessandra Fiorio, University of Lille, France N/A Human PANC-1 Prof. Anna Trauzold, University of Kiel, Germany N/A Experimental models: Organisms/strains Female athymic Nude Crl:NU(NCr)-Foxn1nu mice Charles River N/A Biological samples Matched Pair – Paraffin Tissue Section BioChain T8235090 Oligonucleotides LentiCRISPR sgSLC4A2 AAGAATCTGCGCCCTTGGCG Invitrogen N/A LentiCRISPR sgNDUFS1 TAGAATGTATGCCTACTTGG Invitrogen N/A siGENOME siControl Dharmacon D-001210-01-05 siGENOME siBNIP3 Dharmacon M-004636-01-0005 siGENOME siPEG10 Dharmacon M-032579-01-0005 siGENOME siSLC16A7 Dharmacon M-007409-01-0005 siGENOME siATP6V0A2 Dharmacon M-019950-00-0005 siGENOME siCEACAM6 Dharmacon M-015306-01-0005 siGENOME siPMP22 Dharmacon M-010616-02-0005 siGENOME siCA9 Dharmacon M-005244-02-0005 siGENOME siSLC4A2 Dharmacon M-007582-01-0005 siGENOME siSLC4A3 Dharmacon M-007583-02-0005 siGENOME siSLC26A3 Dharmacon M-007492-00-0005 siGENOME siSLC26A6 Dharmacon M-007494-01-0005 siGENOME siTFEB Dharmacon M-009798-02-0005 siGENOME ATG5 Dharmacon M-004374-04-0005 Recombinant DNA lentiCRISPR v2 Sanjana et al., 201459 Addgene: 52961 Article Title: Dynamic IL-6R/STAT3 signaling leads to heterogeneity of metabolic phenotype in pancreatic ductal adenocarcinoma cells. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains 5-alpha Competent E. coli (High Efficiency) New England Biolabs C2987H Premo FUCCI Cell Cycle Sensor (BacMam 2.0) Life Technologies P36238 Recombinant DNA Laconic/pcDNA3.1( ) San Martin et al., 201325 Addgene: 44238 lentiCRISPR v2 Sanjana et al., 201449 Addgene: 52961 Generated:Article Title: Relative expression of KLK5 to LEKTI is associated with aggressiveness of oral squamous cell carcinoma Article Snippet: Both synthesis of primers and oligos and sequencing of PCR products and clones were performed at the Food and Drug Administration - Center for Biologics Evaluation and Research (CBER) Facility for Biotechnology Resources at National Institutes of Health (Bethesda, MD, USA). .. The generated Transfection:Article Title: Relative expression of KLK5 to LEKTI is associated with aggressiveness of oral squamous cell carcinoma Article Snippet: Both synthesis of primers and oligos and sequencing of PCR products and clones were performed at the Food and Drug Administration - Center for Biologics Evaluation and Research (CBER) Facility for Biotechnology Resources at National Institutes of Health (Bethesda, MD, USA). .. The generated Plasmid Preparation:Article Title: Relative expression of KLK5 to LEKTI is associated with aggressiveness of oral squamous cell carcinoma Article Snippet: Both synthesis of primers and oligos and sequencing of PCR products and clones were performed at the Food and Drug Administration - Center for Biologics Evaluation and Research (CBER) Facility for Biotechnology Resources at National Institutes of Health (Bethesda, MD, USA). .. The generated Virus:Article Title: Dynamic IL-6R/STAT3 signaling leads to heterogeneity of metabolic phenotype in pancreatic ductal adenocarcinoma cells. Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains 5-alpha Competent E. coli (High Efficiency) New England Biolabs C2987H Premo FUCCI Cell Cycle Sensor (BacMam 2.0) Life Technologies P36238 Recombinant DNA Laconic/pcDNA3.1( ) San Martin et al., 201325 Addgene: 44238 lentiCRISPR v2 Sanjana et al., 201449 Addgene: 52961 |